MRNAfold
Tools for designing optimised mRNA sequences using mRNA folding algorithms
Install / Use
/learn @maxhwardg/MRNAfoldREADME
mRNAfold
Table of Contents
Basic Information
This repository contains the "mRNAfold" software package. This package comprises code for mRNA folding algorithms written by Dr Max Ward. These algorithms can be used to design optimised mRNA sequences quickly and easily. The algorithms are written in C++ and a Python runner is included.
The phrase "mRNA folding" refers to a specific algorithmic strategy that extends RNA folding algorithms to designing optimised mRNA sequences. Similar algorithms include LinearDesign, CDSfold, and DERNA.
This software package has several advantages over existing packages. It supports the following notable features:
- Suboptimal folding allowing users to get multiple mRNA sequences that are near optimal. At time of writing no other software has this feature. Novel algorithms were developed to enable this, which are soon to be published
- Techniques to that increase the diversity of suboptimal samples. At time of writing no other software has this feature. Novel algorithms were developed to enable this, which are soon to be published
- Supports MFE and CAI optimisation (like LinearDesign and DERNA)
- Multithreaded algorithms (utilizing the C++ standard library)
- Very efficient code. mRNAfold is competitive with LinearDesign despite mRNAfold employing an exact algorithm and LinearDesign using an approximation. In addition, with multithreading enabled mRNAfold is extremely fast. On a 16-core AMD 7950X with a protein comprising 1500 amino acids LinearDesign took 302s and mRNAfold took 46s (DERNA and CDSfold are much slower than both).
- Can incoporate the UTRs into the optimisation
- Can force or ban codons at specific positions in the sequence
Citation
For now please cite as in the following BibTeX entry.
@software{mrnafold2024,
author = {Ward, Max},
year = {2024},
month = {12},
title = {{mRNAfold Software Package}},
url = {https://github.com/maxhwardg/mRNAfold},
version = {0.0.0},
}
When a paper is published it will be added here.
Build Guide
Several steps must be followed exactly to build the program. These steps should work on up-to-date Linux images. These steps have been tested to work on a clean Ubuntu 24.04 install.
Start by using update/upgrade the ensure our system is up-to-date.
sudo apt update
sudo apt upgrade
Make sure the GNU C++ compiler is installed: sudo apt install g++
Alternatively Clang can be used: sudo apt install clang
Next, let's check the compiler version.
g++ --version or clang++ --version
The code was developed and tested using clang 18.1.3. The code has also been tested with g++ 13.3.0.
Since the code is written using modern C++20, we need up-to-date compiler and toolchain support. Older version of Ubuntu and other Linux distros may require manually installing a newer toolchain. You may need to configure CMake to use a specific compiler if your system default is insufficient.
We also use several libraries and tools including CMake and Intel TBB. We will install these next.
sudo apt install cmake libtbb-dev
Now we are ready to build the program. We use out of source builds with CMake. Let's start by making the build folder. First, make sure we are the root directory of this project.
Run: ls
This should show: configs cpp_src LICENSE pysrc README.md
Next, create the build directory: mkdir build
Next, configure build/ directory in release mode with cmake: cmake -S cpp_src/ -B build/ -DCMAKE_BUILD_TYPE=Release
This should produce something like:
-- The CXX compiler identification is GNU 13.3.0
-- Detecting CXX compiler ABI info
-- Detecting CXX compiler ABI info - done
-- Check for working CXX compiler: /usr/bin/c++ - skipped
-- Detecting CXX compile features
-- Detecting CXX compile features - done
-- Configuring done (0.3s)
-- Generating done (0.0s)
-- Build files have been written to: /pathto/mRNAfold/build
Next, we must go to the build directory and build it. First, let's go to there: cd build
Next, we use make to build the code: make all
This may produce some output. This can be ignored so long as it does not error or crash. No errors should occur and the process should complete with the following final line: [100%] Built target fold_codon_graph
Now we can run the fold_codons_graph program. It is best to do this from the project directory. Let's get back there: cd ../. It is called the fold_codon_graph program since it does mRNA folding using a "codon graph", which is a technique related to those used by LinearDesign and CDSfold.
Now, we can run fold_codons: ./build/exe/fold_codon_graph
This will print out usage instructions:
Usage: ./build/exe/fold_codon_graph <config_file_path>
The way fold_codons works is to take a single argument, which is the path to a configuration file.
This file sets all the parameters for the program to run. Some example config files are given in the
configs directory. Running ls configs should show something like the following:
egfp_example.config epo_example.config ffluc_example.config ...
Looking at these files should provide details about how to make your own config files.
In short, a config must provide a number of arguments each on its own line. Each line contains the name of the argument, then the value separated by a space.
These lines can be in any order, and all of them are optional except aa_seq. If they are not given, a default value is used.
We can run an example with ./build/exe/fold_codon_graph ./configs/minigfp_example2.config
This should produce many suboptimal folds that look like the following.
AUGGAAAAGUCCUUUGUGAUUACUGACCCAUGGCUGCCCGACUAUCCUAUCAUCAGCGCCAGCGACGGCUUUCUGGAGCUGACUGAGUAUAGUCGGGAGGAGAUCAUGGGCAGGAACGCCCGGUUUCUGCAGGGGCCUGAGACCGAUCAGGCCACCGUGCAGAAGAUCCGGGAUGCUAUACGGGAUCGGAGGCCCACUACUGUGCAGCUGAUCAACUACACCAAGAGCGGGAAGAAGUUCUGGAAUUUGUUGCAUCUGCAGCCCGUGUUUGACGGAAAAGGCGGGCUGCAGUAUUUCAUCGGCGUGCAGCUGGUGGGCUCUGAUCACGUG
(.((.(...).))...)......((.(((((((((.(((((((((....((((((((.(((((....)))....)).))))).)))..))))))))).))...)))))))))((....(((((.((((((((((((((((......))))))).)).)))))))...)))))...)).(((((.((((((.((((((((((((((.((((..((((....((.(((((........))))))).....))))...(((((((((((.(((......))).)))))))))))........)))))))))).))))))))))))))).))))
Score: -113.5977
EFE: -161.1318
CAI: 0.9048
AUGGAAAAAUCCUUCGUGAUUACUGACCCAUGGCUGCCCGACUAUCCUAUCAUCAGCGCCAGCGAUGGCUUCCUGGAGCUGACUGAGUAUAGUCGGGAGGAGAUCAUGGGCAGGAACGCCCGGUUUCUGCAGGGGCCUGAGACCGAUCAGGCCACCGUGCAGAAGAUCCGGGAUGCUAUACGGGAUCGGAGGCCCACUACUGUGCAGCUGAUCAACUACACCAAGAGCGGGAAGAAGUUCUGGAAUUUGUUGCAUCUGCAGCCCGUGUUUGACGGAAAAGGCGGGCUGCAGUAUUUCAUCGGCGUGCAGCUGGUGGGCUCUGAUCACGUG
(((((.......)))))......((.(((((((((.(((((((((....((((((((.((((.((....)).)))).))))).)))..))))))))).))...)))))))))((....(((((.((((((((((((((((......))))))).)).)))))))...)))))...)).(((((.((((((.((((((((((((((.((((..((((....((.(((((........))))))).....))))...(((((((((((.(((......))).)))))))))))........)))))))))).))))))))))))))).))))
Score: -122.9577
EFE: -163.9839
CAI: 0.9038
Example Config Files
There are several useful features demonstrated in the example config files. Let us begin with a description of some of the most useful parameters.
aa_seq MVSKGEELFTG: Amino acid sequence to fold. E.g., "MVSKGEELFTG". This is a required parameterparallel false: Set totrueif a parallel algorithm should be used andfalseotherwise. Defaults tofalseif nothing is provided.lambda 1.0: The weight given to Codon Adaptation Index (CAI). The program will produce solutions in order of their score, which isMFE - ln(cai)*lambda. A lambda of 1.0 weights CAI and MFE roughly equally, while 0.0 ignores CAI and lambda=infinity ignores MFE. Note that MFE means Minimum Free Energy, and is a measure of structural stability. This defaults to 1.0 if nothing is provided.subopt_randomness 0.0: Amount of noise in the suboptimal sampling. Useful for increasing the diversity of the samples. This is a percentage, and should be between 0 and 1 where 0.1 would mean that 10% of the score of a traceback is contributed by noise. The score with this parameter included is MFE - ln(cai)*cai_lambda + noise. This defaults to 0.0 if not provided.num_subopt_traces 100: The number of results to generate. If not provided defaults to 100.num_subopt_rounds 1: The number of rounds of suboptimal sampling to run. The total number of samples will be num_subopt_traces * num_subopt_rounds. Note that rounds get executed in parallel if parallel is set to True. Each round will get a different random seed derived from the root seed value. This is useful for getting a more diverse set of samples. It is also useful for making use of multiple cores during sampling. It is recommended to use this in combination with either subopt_randomness otherwise each round will generate the same results. If not provided defaults to 1.rng_seed 0: The root seed value to use for randomness (e.g., in subopt_randomness). Defaults to 0 if not provided.
More details of the parameters can be found by looking at the FoldCodonsConfig documentation in pysrc/fold_codons.py. In addition, configs/ contains examples.
The following files are good examples of the basic parmeters: minigfp_example1.config, minigfp_example2.config, and egfp_example.config. In addition, ffluc_example.config and lacz_example.config are similarly good examples using longer sequences, but are much slower to run.
See minigfp_example3.config. It demonstrates the usage of utr_5p, utr_3p, which can be used to add UTRs. T
