adapter4srna

Adapter in small RNA sequencing

This is an open access reporitory to collect all used adapter sequences in currently commercial available and discontinued kits.

Any comments and contributions are welcomed.

3' adapter for small RNA sequencing on Illumina platform

| Vendor | Kit | Version | 3' Adapter sequence | |:-----------:|:-----------:|-----------:|-----------| | New England Biolabs | NEBNext Multiplex Small RNA Library Prep Kit for Illumina | V3 | 5'-AGATCGGAAGAGCACACGTCT-3' | | Illumina | TruSeq Small RNA | Version | 5’-TGGAATTCTCGGGTGCCAAGG-3' | | PerkinElmer | NEXTflex Small RNA Sequencing Kit ** | V3 | 5’-TGGAATTCTCGGGTGCCAAGG-3' | | Qiagen | QIAseq miRNA Library Kit | Version | 5’-AACTGTAGGCACCATCAAT-3' | | Lexogen | Small RNA-Seq Library Prep Kit | Version | 5’-TGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC-3' | | SeqMatic | TailorMix miRNA Sample Preparation Kit | V2 | 5’-TGGAATTCTCGGGTGCCAAGG-3' | | Takara | SMARTer smRNA-Seq Kit for Illumina | Version | 5’-AAAAAAAAAA-3' | | TriLink | CleanTag Small RNA Library Prep Kit | Version | 5'-TGGAATTCTCGGGTGCCAAGG-3' | | Diagenode | CATS small RNA-seq Kit | Version | 5'-GATCGGAAGAGCACACGTCTG-3' | | GenXPro | TrueQuant SmallRNA Seq Kit for Ultra Low Input | Version | TODO | | ~~Epicentre~~ | ~~ScriptMiner Small RNA-Seq Library Preparation Kit~~ | ~~Version~~ | ~~ ~~ | | ~~Life Technology~~ | ~~SREK, Small RNA Expression Kit~~ | ~~version C~~ | ~~ ~~ |

**4 random bases

~~Kit~~ Discontinued kit

CATS Small RNA sequencing kit for Illumina

Version 2 | 01.17

cutadapt -u 3 input_file.fastq | cutadapt -a AAAAAAAA - | cutadapt -a AAAAAAAN$ -a AAAAAAN$ -a AAAAAN$ - | cutadapt -a AGAGCACACGTCTG - | cutadapt -O 8 -g GTTCAGAGTTCTACAGTCCGACGATCNNN - | cutadapt -m 18 -o output_file.fastq -

Version 2 | 03.17

cutadapt -u 3 input_file.fastq | cutadapt -a AAAAAAAA - | cutadapt -a AAAAAAAN$ -a AAAAAAN$ -a AAAAAN$ - | cutadapt -a AGAGCACACGTCTG - | cutadapt -O 8 -g GTTCAGAGTTCTACAGTCCGACGATCNNN - | cutadapt -m 18 -o output_file.fastq -

Version 2 | 09.17

cutadapt --trim-n -a GATCGGAAGAGCACACGTCTG -a AGAGCACACGTCTG <input.file> | cutadapt -u 3 -a A{100} --no-indels -e 0.16666666666666666 - | cutadapt -O 8 --match-read-wildcards -g GTTCAGAGTTCTACAGTCCGACGATCSSS -m 18 -o <output.file> -

Contributing

Any comments and contributions are welcome. Pull requests are welcome.