SkillAgentSearch skills...

Fastplong

Ultra-fast preprocessing and quality control for long-read sequencing data

Install / Use

/learn @OpenGene/Fastplong
About this skill

Quality Score

0/100

Supported Platforms

Universal

README

install with conda

fastplong

Ultrafast preprocessing and quality control for long reads (Nanopore, PacBio, Cyclone, etc.).
If you're searching for tools to preprocess short reads (Illumina, MGI, etc.), please use fastp

fastplong supports batch processing of multiple FASTQ files in a folder, see - batch processing

simple usage

fastplong -i in.fq -o out.fq

Both input and output can be gzip compressed. By default, the HTML report is saved to fastplong.html (can be specified with -h option), and the JSON report is saved to fastplong.json (can be specified with -j option).

examples of report

fastplong creates reports in both HTML and JSON format.

  • HTML report: http://opengene.org/fastplong/fastplong.html
  • JSON report: http://opengene.org/fastplong/fastplong.json

get fastplong

install with Bioconda

install with conda

conda install -c bioconda fastplong

download the latest prebuilt binary for Linux users

This binary was compiled on CentOS, and tested on CentOS/Ubuntu

# download the latest build
wget http://opengene.org/fastplong/fastplong
chmod a+x ./fastplong

# or download specified version, i.e. fastplong v0.2.2
wget http://opengene.org/fastplong/fastplong.0.2.2
mv fastplong.0.2.2 fastplong
chmod a+x ./fastplong

or compile from source

fastplong depends on libdeflate and isa-l for fast decompression and compression of zipped data, and depends on libhwy for SIMD acceleration. It's recommended to install all of them via Anaconda:

conda install conda-forge::libdeflate
conda install conda-forge::isa-l
conda install conda-forge::libhwy

You can also try to install them with other package management systems like apt/yum on Linux, or brew on MacOS. Otherwise you can compile them from source (https://github.com/intel/isa-l, https://github.com/ebiggers/libdeflate, and https://github.com/google/highway)

download and build fastplong

# get source (you can also use browser to download from master or releases)
git clone https://github.com/OpenGene/fastplong.git

# build
cd fastplong
make -j

# test
make test

# Install
sudo make install

input and output

Specify input by -i or --in, and specify output by -o or --out.

  • if you don't specify the output file names, no output files will be written, but the QC will still be done for both data before and after filtering.
  • the output will be gzip-compressed if its file name ends with .gz

output to STDOUT

fastplong supports streaming the passing-filter reads to STDOUT, so that it can be passed to other compressors like bzip2, or be passed to aligners like minimap2 or bowtie2.

  • specify --stdout to enable this mode to stream output to STDOUT

input from STDIN

  • specify --stdin if you want to read the STDIN for processing.

store the reads that fail the filters

  • give --failed_out to specify the file name to store the failed reads.
  • if one read failed and is written to --failed_out, its failure reason will be appended to its read name. For example, failed_quality_filter, failed_too_short etc.

process only part of the data

If you don't want to process all the data, you can specify --reads_to_process to limit the reads to be processed. This is useful if you want to have a fast preview of the data quality, or you want to create a subset of the filtered data.

do not overwrite exiting files

You can enable the option --dont_overwrite to protect the existing files not to be overwritten by fastplong. In this case, fastplong will report an error and quit if it finds any of the output files (read, json report, html report) already exists before.

split the output to multiple files for parallel processing

See output splitting

fastplong workflow

fastplong workflow

filtering

Multiple filters have been implemented.

quality filter

Quality filtering is enabled by default, but you can disable it by -Q or disable_quality_filtering.

fastplong supports filtering by limiting the N base number (--n_base_limit, disabled by default) and N base percentage (-n, --n_percent_limit, enabled by default). For example, to limit the N base no more than 100, and no more than 20%, you can use the command:

fastplong -i in.fq -o out.fq --n_base_limit 100 --n_percent_limit 20

To filter reads by its percentage of unqualified bases, two options should be provided:

  • -q, --qualified_quality_phred       the quality value that a base is qualified. Default 15 means phred quality >=Q15 is qualified.
  • -u, --unqualified_percent_limit   how many percents of bases are allowed to be unqualified (0~100). Default 40 means 40%

You can also filter reads by its average quality score

  • -m, --mean_qual if one read's average quality score <avg_qual, then this read is discarded. Default 0 means no requirement (int [=0])

length filter

Length filtering is enabled by default, but you can disable it by -L or --disable_length_filtering. The minimum length requirement is specified with -l or --length_required.

You can specify --length_limit to discard the reads longer than length_limit. The default value 0 means no limitation.

Other filter

New filters are being implemented. If you have a new idea or new request, please file an issue.

adapters

fastplong trims adapter in both read start and read end. Adapter trimming is enabled by default, but you can disable it by -A or --disable_adapter_trimming.

fastplong -i in.fq -o out.fq -s AAGGATTCATTCCCACGGTAACAC -e GTGTTACCGTGGGAATGAATCCTT
  • If the adapter sequences are known, it's recommended to specify -s, --start_adapter for read start adapter sequence, and -e, --end_adapter for read end adapter sequence as well.

  • If --end_adapter is not specified but --start_adapter is specified, then fastplong will use the reverse complement sequence of start_adapter to be end_adapter.

  • You can also specify -a, --adapter_fasta to give a FASTA file to tell fastplong to trim multiple adapters in this FASTA file. Here is a sample of such adapter FASTA file:

>Adapter 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
>Adapter 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
>polyA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  • The adapter sequence in the FASTA file should be at least 6bp long, otherwise it will be skipped. And you can give whatever you want to trim, rather than regular sequencing adapters (i.e. polyA).

  • If all these adapter options (start_adapter, end_adapter and adapter_fasta) are not specified, fastplong will try to detect the read start and read end adapters automatically. The detected adapter sequences may be a bit shorter or longer than the real ones. And there is a certain probability of misidentification, especially when most reads don't have adapters (it won't cause too bad result in this case).

  • fastplong calculates edit distance when detecting adapters. You can specify the -d, --distance_threshold to adjust the mismatch tolerance of adapter comparing. The default value is 0.25, which means allowing 25% mismatch ratio (i.e. allow 10 distance for 40bp adapter). Suggest to increase this value when the data is much noisy (high error rate), and decrease this value when the data is with high quality (low error rate).

  • to make a cleaner trimming, fastplong will trim a little more bases connected to the adapters. This option can be specified by --trimming_extension, with a default value of 10.

per read cutting by quality score

fastplong supports per read sliding window cutting by evaluating the mean quality scores in the sliding window. fastplong supports 2 different operations, and you enable one or both:

  • -5, --cut_front move a sliding window from front (5') to tail, drop the bases in the window if its mean quality is below cut_mean_quality, stop otherwise. Default is disabled. The leading N bases are also trimmed. Use cut_front_window_size to set the widnow size, a

Related Skills

View on GitHub
GitHub Stars226
CategoryDevelopment
Updated19h ago
Forks15

Languages

C++

Security Score

95/100

Audited on Apr 1, 2026

No findings